AB.pCCL.sin.cPPT.U6.miR-125b-3p-Decoy.hPGK.GFP.WPRE
(Plasmid
#46582)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAB.pCCLsin.PPT.U6.hPGK.GFP.wpre
- Backbone size w/o insert (bp) 8233
-
Vector typeLentiviral
-
Selectable markerseGFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-125b-3p Decoy
-
Alt name8182
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)81
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer CATAATAGCAACAGACATAC
- 3′ sequencing primer pBluescriptSK_primer (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Depositor Website: http://www.mountsinai.org/profiles/brian-d-brown/ Please cite Mullokandov, Baccarini, Ruzo et al. Nature Methods 2013.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AB.pCCL.sin.cPPT.U6.miR-125b-3p-Decoy.hPGK.GFP.WPRE was a gift from Brian Brown (Addgene plasmid # 46582 ; http://n2t.net/addgene:46582 ; RRID:Addgene_46582) -
For your References section:
High-throughput assessment of microRNA activity and function using microRNA sensor and decoy libraries. Mullokandov G, Baccarini A, Ruzo A, Jayaprakash AD, Tung N, Israelow B, Evans MJ, Sachidanandam R, Brown BD. Nat Methods. 2012 Jul 1;9(8):840-6. doi: 10.1038/nmeth.2078. 10.1038/nmeth.2078 PubMed 22751203