-
PurposeTarget EGFP gene that is stably integrated into HEK293 genome
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 46919 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneMSCV-puro
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 6300
- Total vector size (bp) 6466
-
Vector typeMammalian Expression, Retroviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFP
-
Insert Size (bp)750
- Promoter SV40
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGCAGGCAGAAGTATGCAAAGC (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
-
Article Citing this Plasmid
Depositor Comments
For more information on Qi and Wiessman Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/Qi-weissman/ and http://www.addgene.org/crispr/qi/
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMLS-SV40-EGFP was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46919 ; http://n2t.net/addgene:46919 ; RRID:Addgene_46919) -
For your References section:
CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981