This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24th & 25th and December 31st & January 1st. For details, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #47855)


Item Catalog # Description Quantity Price (USD)
Plasmid 47855 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3967
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    tetAC terminator
  • Species
  • Promoter pLTetO10

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer Neo-R
  • 3′ sequencing primer p15A-R
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses

Depositor Comments

Terminator efficiency measured at 50%.

Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFAB820 was a gift from Drew Endy (Addgene plasmid # 47855 ; ; RRID:Addgene_47855)
  • For your References section:

    Precise and reliable gene expression via standard transcription and translation initiation elements. Mutalik VK, Guimaraes JC, Cambray G, Lam C, Christoffersen MJ, Mai QA, Tran AB, Paull M, Keasling JD, Arkin AP, Endy D. Nat Methods. 2013 Apr;10(4):354-60. doi: 10.1038/nmeth.2404. Epub 2013 Mar 10. 10.1038/nmeth.2404 PubMed 23474465