pFAB1907
(Plasmid
#47857)
-
PurposeBIOFAB reporter plasmid for measuring BBa_B1006 U10 termination efficiency
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47857 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFAB774
- Backbone size w/o insert (bp) 3967
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBBa_B1006 U10
-
SpeciesSynthetic
-
MutationAdded two extra U at the end of Bba_1006 poly-U tail
- Promoter pLTetO12
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer Neo-R
- 3′ sequencing primer p15A-R (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Terminator efficiency measured at 99%.
Terminator inserted between RFP and GFP and flanked by Rnase III sites. RNase sites have sequences GTGATAGACTCAAGGTCGCTCCTAGCGAGTGGCCTTTATGATTATCAC and AGAGGGACAAACTCAAGGTCATTCGCAAGAGTGGCCTTTATGATTGACCTTCT, respectively. Terminator can be amplified by PCR with or without these sites, as desired.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFAB1907 was a gift from Drew Endy (Addgene plasmid # 47857 ; http://n2t.net/addgene:47857 ; RRID:Addgene_47857) -
For your References section:
Precise and reliable gene expression via standard transcription and translation initiation elements. Mutalik VK, Guimaraes JC, Cambray G, Lam C, Christoffersen MJ, Mai QA, Tran AB, Paull M, Keasling JD, Arkin AP, Endy D. Nat Methods. 2013 Apr;10(4):354-60. doi: 10.1038/nmeth.2404. Epub 2013 Mar 10. 10.1038/nmeth.2404 PubMed 23474465