Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET LIC cloning vector with BioBrick polycistronic restriction sites (9A)
(Plasmid #48283)


Item Catalog # Description Quantity Price (USD)
Plasmid 48283 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy


  • Gene/Insert name

Resource Information

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

To clone into this vector, add LIC version 2 fusion tags to the 5' end of your PCR primers.
Reverse - 5'TTATGGAGTTGGGATCTTATTA3'In addition, ensure that your open reading frame contains an ATG start codon.

Linearize the plasmid with EcoRV and gel purify.

When digesting the DNA with T4 polymerase for LIC version 2, use dGTP for insert and dCTP for vector. Series 9 vectors have BioBrick restriction sites to facilitate subcloning reactions to make polycistronic expression vectors. NotI, PacI, AsiSI, and SbfI are the restriction enzyme sites that flank your open reading frame. More information on this vector can be found through

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET LIC cloning vector with BioBrick polycistronic restriction sites (9A) was a gift from Scott Gradia (Addgene plasmid # 48283 ; ; RRID:Addgene_48283)