Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
Holiday Schedule: Addgene will be closed December 24 - January 1, 2020. For more information, see our holiday shipping schedule. If you have any questions, please contact us at [email protected].

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pET co-transformation cloning vector (13S-A)
(Plasmid #48323)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 48323 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    None

Resource Information

  • Terms and Licenses

Depositor Comments

This plasmid is an empty vector to be used with a LIC cloning protocol.

It has a Spec resistance.

To clone into this vector, add LICv2 fusion tags to the 5' end of your PCR primers.
LICv2 Forward - 5'TTTAAGAAGGAGATATAGATC3'
LICv2 Reverse - 5'TTATGGAGTTGGGATCTTATTA3'

Linearize the plasmid with EcoRV and gel purify.

When digesting the DNA with T4 polymerase for LIC, use dCTP for insert and dGTP for vector. The 13-series vectors were designed to enable rapid cloning for a co-expression system. Vectors are based on Novagen's Duet system. Each gene is expressed on its own vector, which has been optimized so that each gene expresses at approximately equal levels. The 13-series vectors are all compatible with 2-series transfer vectors, so if cotransformation fails, there is a readily available backup in polycistronic expression.

13S CDF origin SpecR13K ColA origin KanR2-series transfer ColE1 origin AmpR13S vectors must be cotransformed with a 2-series vector for optimal expression (that is, the presence of an empty 2A-T vector enhances expression of a gene in 13S). For triple expressions, the proteins all seem to express at approximately equal levels. Genes in the CDF vector consistently express at very slightly lower levels, so if you're trying to pull down stoichiometric complexes, it's probably best to put His6-fusion protein in this vector. More information on this vector can be found through http://qb3.berkeley.edu/qb3/macrolab/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET co-transformation cloning vector (13S-A) was a gift from Scott Gradia (Addgene plasmid # 48323 ; http://n2t.net/addgene:48323 ; RRID:Addgene_48323)