pUC19 gene 60
(Plasmid
#49090)
-
PurposeTemplate for generating full length gene 60 mRNA by in vitro transcription with T7 RNA pol
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49090 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2662
- Total vector size (bp) 3319
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)JM109
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBacteriophage T4 gene 60
-
SpeciesEnterobacteria phage T4
-
Insert Size (bp)657
-
GenBank IDM19728.1
- Promoter T7
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer tgtaaaacgacggccagt
- 3′ sequencing primer caggaaacagctatgaccatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19 gene 60 was a gift from Nils Walter (Addgene plasmid # 49090 ; http://n2t.net/addgene:49090 ; RRID:Addgene_49090) -
For your References section:
Secondary structure of bacteriophage T4 gene 60 mRNA: implications for translational bypassing. Todd GC, Walter NG. RNA. 2013 May;19(5):685-700. doi: 10.1261/rna.037291.112. Epub 2013 Mar 14. 10.1261/rna.037291.112 PubMed 23492219