Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #49152)


Item Catalog # Description Quantity Price (USD)
Plasmid 49152 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    mCh-alpha tubulin (Addgene plasmid )
  • Backbone manufacturer
    Voeltz lab
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Alt name
  • Alt name
    dynamin 1-like
  • Alt name
    Drp1, isoform 3
  • Species
    H. sapiens (human)
  • GenBank ID
  • Entrez Gene
  • Promoter CMV
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer mCherry-F (ccccgtaatgcagaagaaga)
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    mCh-Drp1 was a gift from Gia Voeltz (Addgene plasmid # 49152 ; ; RRID:Addgene_49152)
  • For your References section:

    ER tubules mark sites of mitochondrial division. Friedman JR, Lackner LL, West M, DiBenedetto JR, Nunnari J, Voeltz GK. Science. 2011 Oct 21;334(6054):358-62. doi: 10.1126/science.1207385. Epub 2011 Sep 1. 10.1126/science.1207385 PubMed 21885730