-
Purposeexpresses Arf1-EGFP in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 49578 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneEGFP N3
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4700
- Total vector size (bp) 5200
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArf1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)555
-
GenBank IDAF493881
-
Entrez GeneARF1 (a.k.a. PVNH8)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer EGFP N CGTCGCCGTCCAGCTCGACCAG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byArf1 derived from pCDNA3.1+Arf1 purchased from Missours S&T cDNA resource center
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Arf1-EGFP was a gift from Marci Scidmore (Addgene plasmid # 49578) -
For your References section:
Multiple host proteins that function in phosphatidylinositol-4-phosphate metabolism are recruited to the chlamydial inclusion. Moorhead AM, Jung JY, Smirnov A, Kaufer S, Scidmore MA. Infect Immun. 2010 May;78(5):1990-2007. doi: 10.1128/IAI.01340-09. Epub 2010 Mar 15. 10.1128/IAI.01340-09 PubMed 20231409