Skip to main content

GBK-Rab6AΔT27NCSC
(Plasmid #49836)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 49836 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    GBK-T7
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7300
  • Total vector size (bp) 7900
  • Vector type
    Yeast Expression
  • Selectable markers
    Neomycin (select with G418), TRP1

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab6A
  • Alt name
    Rab6A isoform b
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    600
  • Mutation
    threonine 27 to asparagine; deleted cysteine 206, serine 207, cysteine 208
  • GenBank ID
  • Entrez Gene
    RAB6A (a.k.a. RAB6)
  • Promoter ADHI
  • Tags / Fusion Proteins
    • Gal4 Binding Domain (N terminal on insert)
    • Myc (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site XhoI/SalI (destroyed during cloning)
  • 5′ sequencing primer T7 (TAATACGACTCACTATAGGG)
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Rab6A cDNA derived from pCDNA3.1+Rab6A purchased from Missouri S&T cDNA Resource Center

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GBK-Rab6AΔT27NCSC was a gift from Marci Scidmore (Addgene plasmid # 49836)