A6TSR
(Plasmid
#50359)
-
Purposeexpresses T.gondii MIC2(67-660) domains in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 50359 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLEXm-LIC
- Backbone size w/o insert (bp) 4500
- Total vector size (bp) 6200
-
Modifications to backboneThe vector is modified for LIC cloning, but the insert can also be extracted using 5' EcoR I/ Nhe I/sal I/BsiW1, and 3' Spe I, Asc I/BssH II/ Not I/Xho I.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMIC2-A6TSR
-
Alt nameMIC2(67-660)
-
Alt nameTRAP Homolog
-
Speciestoxoplasma gondii
-
Insert Size (bp)1782
-
MutationS158A, N357S, N463S, N470D
-
GenBank IDAAB63303
- Promoter CHICK beta-actin promoter
-
Tag
/ Fusion Protein
- HIS (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAGAGCCTCTGCTAACCATGTTCATGCC
- 3′ sequencing primer CCCCATAATTTTTGGCAGAGGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. David Sibley Washington University School of Medicine
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
A6TSR was a gift from Timothy Springer (Addgene plasmid # 50359 ; http://n2t.net/addgene:50359 ; RRID:Addgene_50359)