Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRKVSV Rac Q61L
(Plasmid #50536)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 50536 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRKVSV
  • Backbone manufacturer
    PMID 14729062
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    small GTPase, mutated
  • Alt name
    Rac I
  • Alt name
    RAC1
  • Species
    H. sapiens (human)
  • Mutation
    Q61L (Constitutively active)
  • Entrez Gene
    RAC1 (a.k.a. MIG5, MRD48, Rac-1, TC-25, p21-Rac1)
  • Promoter CMV
  • Tag / Fusion Protein
    • 2X VSV (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer pRK KZ FW (TAGAATAACATCCACTTTGCC)
  • 3′ sequencing primer GFP ASO (TTGTAACCATTATAAGCTGC)
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRKVSV Rac Q61L was a gift from Kenneth Yamada (Addgene plasmid # 50536 ; http://n2t.net/addgene:50536 ; RRID:Addgene_50536)
  • For your References section:

    Glycogen synthase kinase-3 regulates cytoskeleton and translocation of Rac1 in long cellular extensions of human keratinocytes. Koivisto L, Hakkinen L, Matsumoto K, McCulloch CA, Yamada KM, Larjava H. Exp Cell Res. 2004 Feb 1;293(1):68-80. 10.1016/j.yexcr.2003.09.026 PubMed 14729058