-
PurposeCRISPR/Cas based plant genome editing and gene regulation; expresses dCas9-KRAB, gRNA scaffold for insertion of target sequence (OsU3 promoter), Bar resistance
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 50580 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepGreen-like binary vector
-
Backbone manufacturerMullineaux Lab, see http://www.pgreen.ac.uk/
-
Vector typeCRISPR ; Plant expression
-
Selectable markersBar
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin and Spectinomycin, 50 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namedCas9-KRAB
-
Alt nameCas9
-
SpeciesSynthetic
-
MutationdCas9 that is defective in DNA cleavage; the maize codon–optimized dCas9-KRAB (Krüppel-associated box) vector was constructed for targeted knockdown of genes of interest.
- Promoter Ubi1p
-
Tags
/ Fusion Proteins
- 3xFLAG (N terminal on insert)
- NLS (N terminal on insert)
- NLS (C terminal on insert)
- HA (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer hSpCas9-R1, CGCTCGTGCTTCTTATCCTC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namegRNA scaffold
-
SpeciesSynthetic
- Promoter OsU3p
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer RB-F1, ggataaaccttttcacgccc (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBUN6I11 was a gift from Qi-Jun Chen (Addgene plasmid # 50580 ; http://n2t.net/addgene:50580 ; RRID:Addgene_50580) -
For your References section:
A CRISPR/Cas9 toolkit for multiplex genome editing in plants. Xing HL, Dong L, Wang ZP, Zhang HY, Han CY, Liu B, Wang XC, Chen QJ. BMC Plant Biol. 2014 Nov 29;14(1):327. 10.1186/s12870-014-0327-y PubMed 25432517