Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pTT5-hSDC1-S15/25A
(Plasmid #52364)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52364 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTT5
  • Backbone manufacturer
    NRC Biotechnology Research Institute
  • Backbone size w/o insert (bp) 4401
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SDC1
  • Alt name
    Syndecan-1 serine 15 and 25 mutated to alanine
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    933
  • Mutation
    S15A, S25A and R95Q (according to numbering in Fig. 2A of associated publication)
  • Entrez Gene
    SDC1 (a.k.a. CD138, SDC, SYND1, syndecan)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (unknown if destroyed)
  • 3′ cloning site BamHI (unknown if destroyed)
  • 5′ sequencing primer CCATACACTTGAGTGACAATGAC
  • 3′ sequencing primer TATGTCCTTCCGAGTGAGAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pTT5 backbone used in his plasmids was obtained from Yves Durocher at National Research Council of Canada (NRC)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTT5-hSDC1-S15/25A was a gift from Gordon Laurie (Addgene plasmid # 52364 ; http://n2t.net/addgene:52364 ; RRID:Addgene_52364)
  • For your References section:

    Targeting of heparanase-modified syndecan-1 by prosecretory mitogen lacritin requires conserved core GAGAL plus heparan and chondroitin sulfate as a novel hybrid binding site that enhances selectivity. Zhang Y, Wang N, Raab RW, McKown RL, Irwin JA, Kwon I, van Kuppevelt TH, Laurie GW. J Biol Chem. 2013 Apr 26;288(17):12090-101. doi: 10.1074/jbc.M112.422717. Epub 2013 Mar 15. 10.1074/jbc.M112.422717 PubMed 23504321