Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #52911)


Item Catalog # Description Quantity Price (USD)
Plasmid 52911 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 4773
  • Total vector size (bp) 6328
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number


  • Gene/Insert name
    Aa Hsp70Aa-1373
  • Species
    Aedes aegypti
  • Insert Size (bp)
  • Promoter Aa Hsp70Aa-1373

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site NcoI (not destroyed)
  • 5′ sequencing primer ATAGGCTGTCCCCAGTGCAAGT
  • 3′ sequencing primer tttcatagcttctgccaaccgaacgg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AaHsp70Aa-1373-FFluc was a gift from Zach Adelman (Addgene plasmid # 52911 ; ; RRID:Addgene_52911)
  • For your References section:

    Identification and characterization of heat shock 70 genes in Aedes aegypti (Diptera: Culicidae). Gross TL, Myles KM, Adelman ZN. J Med Entomol. 2009 May;46(3):496-504. PubMed 19496419