pBullet-cg-c
(Plasmid
#53070)
-
Purpose(Empty Backbone) destination vector with cis-golgi marker (alpha-man I 49AA) -ECFP for tagged fluorescent protein (C-ter-EYFP) of plant gene
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53070 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBullet
-
Backbone manufacturerJBEI
- Backbone size (bp) 8000
-
Vector typeSynthetic Biology
-
Selectable markersNeomycin (select with G418) ; Kanamycin
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer ACAAGTTTGTACAAAAAAGCAGGCTTC
- 3′ sequencing primer ACCACTTTGTACAAGAAAGCTGGGTC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
See http://gt.jbei.org/ for more information on the JBEI glycosyltransferase collection.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBullet-cg-c was a gift from Joshua Heazlewood (Addgene plasmid # 53070 ; http://n2t.net/addgene:53070 ; RRID:Addgene_53070) -
For your References section:
The Plant Glycosyltransferase Clone Collection for Functional Genomics. Lao J, Oikawa A, Bromley JR, McInerney P, Suttangkakul A, Smith-Moritz AM, Plahar H, Chiu TY, Gonzalez Fernandez-Nino SM, Ebert B, Yang F, Christiansen KM, Hansen SF, Stonebloom S, Adams PD, Ronald PC, Hillson NJ, Hadi MZ, Vega-Sanchez ME, Loque D, Scheller HV, Heazlewood1 JL. Plant J. 2014 Jun 6. doi: 10.1111/tpj.12577. 10.1111/tpj.12577 PubMed 24905498