pBR322-MCK1.35lux
(Plasmid
#53368)
-
Purposeexpresses luciferase under 1.35 kb muscle creatine kinase promoter/enhancer
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53368 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBR322
- Backbone size w/o insert (bp) 4361
- Total vector size (bp) 6150
-
Modifications to backboneAmp resistance gene and origin of replication from pBR322. MCK 1.35 promoter/enhancer can be excised with AatII or NdeI at 5', and HindIII or EcoRI at 3' end. Luciferase gene (Photinus pyralis). SV40 pA.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemuscle creatine kinase promoter/enhancer 1.35kb
-
Alt nameMCK1.35
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1354
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI, AatII (not destroyed)
- 3′ cloning site HindIII, EcoRI (not destroyed)
- 5′ sequencing primer CTGTCATGCCATCCGTAAGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBR322-MCK1.35lux was a gift from Josephine Nalbantoglu (Addgene plasmid # 53368 ; http://n2t.net/addgene:53368 ; RRID:Addgene_53368) -
For your References section:
Efficient muscle-specific transgene expression after adenovirus-mediated gene transfer in mice using a 1.35 kb muscle creatine kinase promoter/enhancer. Larochelle N, Lochmuller H, Zhao J, Jani A, Hallauer P, Hastings KE, Massie B, Prescott S, Petrof BJ, Karpati G, Nalbantoglu J. Gene Ther. 1997 May;4(5):465-72. 10.1038/sj.gt.3300414 PubMed 9274724