Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3/Flag-METTL14
(Plasmid #53740)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53740 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5446
  • Total vector size (bp) 6759
  • Modifications to backbone
    N.A.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    N.A.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Methyltransferase-like 14
  • Alt name
    METTL14
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1371
  • GenBank ID
    NM_020961.2
  • Entrez Gene
    METTL14 (a.k.a. hMETTL14)
  • Promoter T7
  • Tag / Fusion Protein
    • FLAG tag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer 5' TAATACGACTCACTATAGGG 3'
  • 3′ sequencing primer 5' ATTTAGGTGACACTATAG 3'
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    cDNA was obtained from Open Biosystems
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3/Flag-METTL14 was a gift from Chuan He (Addgene plasmid # 53740 ; http://n2t.net/addgene:53740 ; RRID:Addgene_53740)
  • For your References section:

    A METTL3-METTL14 complex mediates mammalian nuclear RNA N6-adenosine methylation. Liu J, Yue Y, Han D, Wang X, Fu Y, Zhang L, Jia G, Yu M, Lu Z, Deng X, Dai Q, Chen W, He C. Nat Chem Biol. 2014 Feb;10(2):93-5. doi: 10.1038/nchembio.1432. Epub 2013 Dec 6. 10.1038/nchembio.1432 PubMed 24316715