Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMIR-His-Halo-Tev-PTEN
(Plasmid #58241)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58241 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMIR
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 6470
  • Total vector size (bp) 8606
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    phosphatase and tensin homolog
  • Alt name
    PTEN
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2136
  • GenBank ID
    NM_000314.4
  • Entrez Gene
    PTEN (a.k.a. 10q23del, BZS, CWS1, DEC, GLM2, MHAM, MMAC1, PTEN1, PTENbeta, TEP1)
  • Promoter CMV
  • Tag / Fusion Protein
    • His-Halo-Tev (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CAGGAAACAGCTATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Aye, Y.; Brignole, E. J.; Long, M. J. C.; Chitturulu, J.; Drennan, C. L.; Asturias, F. J.;
Stubbe J. Chem. Biol. 2012, 19, 799-805

Yen, H-C.S., Xu, Q., Chou, D.M., Zhao, Z., and Elledge, S.J. (2008). Global protein stability
profiling in mammalian cells. Science 322, 918−923.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMIR-His-Halo-Tev-PTEN was a gift from Yimon Aye (Addgene plasmid # 58241 ; http://n2t.net/addgene:58241 ; RRID:Addgene_58241)
  • For your References section:

    Temporally controlled targeting of 4-hydroxynonenal to specific proteins in living cells. Fang X, Fu Y, Long MJ, Haegele JA, Ge EJ, Parvez S, Aye Y. J Am Chem Soc. 2013 Oct 2;135(39):14496-9. doi: 10.1021/ja405400k. Epub 2013 Sep 18. 10.1021/ja405400k PubMed 24015839