Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pBabe-Puro-FLAG-Neuroserpin oloop
(Plasmid #58262)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 58262 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBABE-Puro
  • Backbone size w/o insert (bp) 5169
  • Total vector size (bp) 6795
  • Vector type
    Mammalian Expression, Retroviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Neuroserpin
  • Alt name
    SERPINI1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1590
  • Mutation
    Mutant of neuroserpin lacking five residues from Gly231 to Ala235
  • GenBank ID
    BC018043.1
  • Entrez Gene
    SERPINI1 (a.k.a. HNS-S1, HNS-S2, PI12, neuroserpin)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gtctctcccccttgaacctc
  • 3′ sequencing primer ATGGCTTCCTCAGGGAAAGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBabe-Puro-FLAG-Neuroserpin oloop was a gift from Joan Massague (Addgene plasmid # 58262 ; http://n2t.net/addgene:58262 ; RRID:Addgene_58262)
  • For your References section:

    Serpins promote cancer cell survival and vascular co-option in brain metastasis. Valiente M, Obenauf AC, Jin X, Chen Q, Zhang XH, Lee DJ, Chaft JE, Kris MG, Huse JT, Brogi E, Massague J. Cell. 2014 Feb 27;156(5):1002-16. doi: 10.1016/j.cell.2014.01.040. 10.1016/j.cell.2014.01.040 PubMed 24581498