Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP
(Plasmid #58490)


Item Catalog # Description Quantity Price (USD)
Plasmid 58490 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
    FUGW (from Addgene plasmid 22051)
  • Backbone manufacturer
    Addgene plasmid 22051
  • Backbone size w/o insert (bp) 9200
  • Total vector size (bp) 10700
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number


  • Gene/Insert name
    Archaerhodopsin-3 w/ D95H point mutation fused to eGFP
  • Alt name
  • Species
    Halorubrum sodomense
  • Insert Size (bp)
  • Mutation
    Changed Aspartic Acid 95 to Glutamine
  • GenBank ID
  • Promoter Ubiquitin
  • Tag / Fusion Protein
    • eGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer ttgaactatgcgctcggggttg
  • 3′ sequencing primer cggtgaacagctcctcgcccttg
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    VV017: Archaerhodopsin-3 w/ D95Q point mutation fused to eGFP was a gift from Adam Cohen (Addgene plasmid # 58490 ; ; RRID:Addgene_58490)
  • For your References section:

    Flash memory: photochemical imprinting of neuronal action potentials onto a microbial rhodopsin. Venkatachalam V, Brinks D, Maclaurin D, Hochbaum D, Kralj J, Cohen AE. J Am Chem Soc. 2014 Feb 12;136(6):2529-37. doi: 10.1021/ja411338t. Epub 2014 Jan 27. 10.1021/ja411338t PubMed 24428326