pRVdG-4ArchT-EGFP
(Plasmid
#59325)
-
PurposeExpresses ArchT-EGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 59325 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonecSPBN (pSAD)
-
Backbone manufacturerKarl-Klaus Conzelmann & Matthias Schnell
- Backbone size w/o insert (bp) 13782
- Total vector size (bp) 15261
-
Vector typeMammalian Expression ; Rabies Virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDH5alpha at 37C
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArchT-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)1479
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CATCAAAGTCAAGTTGATTACC
- 3′ sequencing primer TAGACCTCTCCAGGATCG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
Alternative name: pRVdG-4ArchTE
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRVdG-4ArchT-EGFP was a gift from Ian Wickersham (Addgene plasmid # 59325 ; http://n2t.net/addgene:59325 ; RRID:Addgene_59325)