pET21a(+)-PA_PhoU
(Plasmid
#59334)
-
PurposePho regulation
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59334 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET21a(+)
-
Backbone manufacturerNovagen
- Backbone size w/o insert (bp) 5443
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namephoU
-
Alt namePA5365
-
Alt namephoU
-
SpeciesPseudomonas aeruginosa PAO1
-
Insert Size (bp)726
-
GenBank IDNC_002516.2
-
Tag
/ Fusion Protein
- His (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (CATATG) (destroyed during cloning)
- 3′ cloning site XhoI (CTCGAG) (destroyed during cloning)
- 5′ sequencing primer GGAATTCCATATGATGATCAACAAAGACAGTCTC
- 3′ sequencing primer CCGCCGCTCGAGTTATCACTCGCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The PhoU ORF has a K139R mutation. This change may be due to an error in the genomic sequencing data. The K139R residue is located on the surface of PhoU protein and the side chain is somewhat disordered, making it difficult to confirm its identity. The mutation should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET21a(+)-PA_PhoU was a gift from SeWon Suh (Addgene plasmid # 59334 ; http://n2t.net/addgene:59334 ; RRID:Addgene_59334)