pCAP01
(Plasmid #59981)

• Purpose: (Empty Backbone) The function of this material is to facilitate the capture and expression of bacterial gene clusters.
• Depositing Lab: Bradley Moore
• Publication: Yamanaka et al Proc Natl Acad Sci U S A. 2014 Feb 4;111(5):1957-62. doi: 10.1073/pnas.1319584111. Epub 2014 Jan 21.

Backbone

• Vector backbone: SuperCos1
• Backbone manufacturer: Agilent
• Backbone size (bp): 7600
• Modifications to backbone: The RP4 origin and attP site was inserted into the vector for heterologous expressing biosynthetic gene cluster in actinobacteria. The vector also contains the TRP1 gene and CEN6_ARS4 for selecting in S. cerevisiae tryptophan deficient mutant.
• Vector type: Bacterial Expression, Yeast Expression, Synthetic Biology ; transformation-associated recombination cloning
• Promoter: no
• Selectable markers: TRP1, URA3
• Tag / Fusion Protein:
  • no

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TATGTCCTGCGGGTAAATAG
• 3′ sequencing primer: TCGGGGAAATGTGCGCGGAA

Resource Information

• Supplemental Documents:
  • TAR Cloning Protocol
• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry