-
PurposeMouse NAIP5 (B6 allele), expressed under the constitutive, moderate-level retroviral LTR promoter for mammalian cell expression; IRES-GFP reporter downstream of NAIP5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60205 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonemscv2.2
-
Vector typeMammalian Expression, Retroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameNAIP5
-
SpeciesM. musculus (mouse)
- Promoter LTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BglII (destroyed during cloning)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer AAGCCCTTTGTACACCCTAAGCC
- 3′ sequencing primer CCTCACATTGCCAAAAGAC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mscv2.2-NAIP5 was a gift from Russell Vance (Addgene plasmid # 60205 ; http://n2t.net/addgene:60205 ; RRID:Addgene_60205) -
For your References section:
Molecular basis for specific recognition of bacterial ligands by NAIP/NLRC4 inflammasomes. Tenthorey JL, Kofoed EM, Daugherty MD, Malik HS, Vance RE. Mol Cell. 2014 Apr 10;54(1):17-29. doi: 10.1016/j.molcel.2014.02.018. Epub 2014 Mar 20. 10.1016/j.molcel.2014.02.018 PubMed 24657167