Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLL7.0: tgRFPt-SSPB R73Q
(Plasmid #60416)


Item Catalog # Description Quantity Price (USD)
Plasmid 60416 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    tgRFPt-SSPB R73Q
  • Species
  • Insert Size (bp)
  • Mutation
    R73Q, Y11K and A15E
  • Promoter CMV
  • Tag / Fusion Protein
    • TagRFPt (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer CAGCAACCAGGATTTATACAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Depositor Comments

The SspB used in this construct contains two amino acid mutations that disrupt the natural dimerization of SspB. These mutations are Y11K and A15E (residue numbering from pdb code 1ou9). Here is the sequence around the mutated residues with the sites of mutation in parentheses: SSPKRP(K)LLR(E)YYDWLVDNS

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLL7.0: tgRFPt-SSPB R73Q was a gift from Brian Kuhlman (Addgene plasmid # 60416 ; ; RRID:Addgene_60416)
  • For your References section:

    Engineering an improved light-induced dimer (iLID) for controlling the localization and activity of signaling proteins. Guntas G, Hallett RA, Zimmerman SP, Williams T, Yumerefendi H, Bear JE, Kuhlman B. Proc Natl Acad Sci U S A. 2015 Jan 6;112(1):112-7. doi: 10.1073/pnas.1417910112. Epub 2014 Dec 22. 10.1073/pnas.1417910112 PubMed 25535392