Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is operating at a reduced capacity.

  • Pending order? We will email to confirm that your organization can accept shipments.
  • Conducting coronavirus or COVID-19 research? Email us at [email protected] with your order or deposit number so we can prioritize it.

Learn more about our current shipping status and COVID-19 resources.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pTSara-C
(Plasmid #60722)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60722 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBAD33
  • Backbone size w/o insert (bp) 5500
  • Total vector size (bp) 7714
  • Modifications to backbone
    Arabinose inducible ORF driving expression of the C-terminal fragment of T7 RNAP split between position 179-180
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Residues 180-880 of T7 RNAP
  • Species
    Synthetic; T7 Phage
  • Insert Size (bp)
    2118
  • Mutation
    Only amino acids 180-880 of T7 RNAP
  • GenBank ID
    GI:216012
  • Promoter PBAD

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GATTATAGACACTTTTGTCGCGATGTTGTGTCTAATTTTGAAGTTAAC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTSara-C was a gift from Matthew Bennett (Addgene plasmid # 60722 ; http://n2t.net/addgene:60722 ; RRID:Addgene_60722)
  • For your References section:

    Library of synthetic transcriptional AND gates built with split T7 RNA polymerase mutants. Shis DL, Bennett MR. Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5028-33. doi: 10.1073/pnas.1220157110. Epub 2013 Mar 11. 10.1073/pnas.1220157110 PubMed 23479654