pHOHO2_Hsp82viiA
(Plasmid #61708)

• Purpose: Yeast integration plasmid targeted to the HO loci with heterodimeric Hsp82. Digest with NotI prior to addition to yeast.
• Depositing Lab: Dan Bolon
• Publication: Mishra et al Mol Cell. 2014 Jan 23;53(2):344-50. doi: 10.1016/j.molcel.2013.12.024.

Backbone

• Vector backbone: pHOHO2
• Vector type: Yeast Expression ; Yeast integration vector targeting inserts to the HO loci
• Selectable markers: HIS3

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): XL1 Blue
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Hsp82viiA
• Alt name: Hsp90
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 2000
• Mutation: Heteromeric coiled coil inserted after amino acid 678; A595C*
• Entrez Gene: HSP82 (a.k.a. YPL240C, HSP90)
• Promoter: TEF1
• Tag / Fusion Protein:
  • 6xHis (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCTTTCGATGACCTCCCATTG
• 3′ sequencing primer: ctccttccttttcggttagag

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

*Note: This plasmid contains an A595C amino acid residue substitution. This residue change does not alter Hsp90 function in yeast but enables cross-dimer disulfide formation under oxidizing conditions. This construct accurately represents the plasmid as it was used in the associated publication.