Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pHOHO2_Hsp82viiA
(Plasmid #61708)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61708 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pHOHO2
  • Vector type
    Yeast Expression ; Yeast integration vector targeting inserts to the HO loci
  • Selectable markers
    HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hsp82viiA
  • Alt name
    Hsp90
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    2000
  • Mutation
    Heteromeric coiled coil inserted after amino acid 678; A595C*
  • Entrez Gene
    HSP82 (a.k.a. YPL240C, HSP90)
  • Promoter TEF1
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTTTCGATGACCTCCCATTG
  • 3′ sequencing primer ctccttccttttcggttagag
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*Note: This plasmid contains an A595C amino acid residue substitution. This residue change does not alter Hsp90 function in yeast but enables cross-dimer disulfide formation under oxidizing conditions. This construct accurately represents the plasmid as it was used in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHOHO2_Hsp82viiA was a gift from Dan Bolon (Addgene plasmid # 61708 ; http://n2t.net/addgene:61708 ; RRID:Addgene_61708)
  • For your References section:

    Designed Hsp90 heterodimers reveal an asymmetric ATPase-driven mechanism in vivo. Mishra P, Bolon DN. Mol Cell. 2014 Jan 23;53(2):344-50. doi: 10.1016/j.molcel.2013.12.024. 10.1016/j.molcel.2013.12.024 PubMed 24462207