p414ADH_Hsp82_noTER
(Plasmid
#61715)
-
Purposeyeast plasmid with Hsp82
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61715 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonep414
-
Vector typeYeast Expression
-
Selectable markersTRP1
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert name6xHis-Hsp82
-
Alt nameHsp90
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)2000
-
Entrez GeneHSP82 (a.k.a. YPL240C, HSP90)
- Promoter ADH1
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer cagctatgaccatgattacg
- 3′ sequencing primer gtaaaacgacggccagtgagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
p414ADH_Hsp82_noTER was a gift from Dan Bolon (Addgene plasmid # 61715 ; http://n2t.net/addgene:61715 ; RRID:Addgene_61715) -
For your References section:
Latent effects of Hsp90 mutants revealed at reduced expression levels. Jiang L, Mishra P, Hietpas RT, Zeldovich KB, Bolon DN. PLoS Genet. 2013 Jun;9(6):e1003600. doi: 10.1371/journal.pgen.1003600. Epub 2013 Jun 27. PGENETICS-D-12-02384 [pii] PubMed 23825969