Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #62196)


Item Catalog # Description Quantity Price (USD)
Plasmid 62196 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 4681
  • Total vector size (bp) 5973
  • Modifications to backbone
    Compatible with Golden Gate TALEN kit
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsmBI (destroyed during cloning)
  • 3′ cloning site BsmBI (destroyed during cloning)
  • 5′ sequencing primer TCGCGAAGAGAGGGGGAGTAAC
  • 3′ sequencing primer ACCAAGACATGCCAACGCCACC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

pZT-C13/CLYBL TALENs were assembled using RVD monomers from Golden Gate TALEN kit 1.0 (TALEN Kit #1000000016) and a mammalian TALEN expression vector pZT

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pZT-C13-L1 was a gift from Jizhong Zou (Addgene plasmid # 62196 ; ; RRID:Addgene_62196)
  • For your References section:

    Transcription activator-like effector nuclease (TALEN)-mediated CLYBL targeting enables enhanced transgene expression and one-step generation of dual reporter human induced pluripotent stem cell (iPSC) and neural stem cell (NSC) lines. Cerbini T, Funahashi R, Luo Y, Liu C, Park K, Rao M, Malik N, Zou J. PLoS One. 2015 Jan 14;10(1):e0116032. doi: 10.1371/journal.pone.0116032. eCollection 2015. PONE-D-14-41442 [pii] PubMed 25587899