pmiR-96 cluster promoter
(Plasmid
#62517)
-
PurposemicroRNA 183-96-182 cluster promoter luciferase plasmid
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 62517 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLightSwitch_Prom
-
Backbone manufacturerSwitchgear Genomics
- Backbone size w/o insert (bp) 3656
- Total vector size (bp) 5996
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namepromoter of microRNA-183-96-182 cluster
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2340
-
Tag
/ Fusion Protein
- RenSP (optimized renilla luciferase gene) (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sac I (unknown if destroyed)
- 3′ cloning site Hind III (unknown if destroyed)
- 5′ sequencing primer TCCATCAAAACAAAACGAAACAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmiR-96 cluster promoter was a gift from Bharat Ramratnam (Addgene plasmid # 62517 ; http://n2t.net/addgene:62517 ; RRID:Addgene_62517) -
For your References section:
Glycogen synthase kinase 3 beta inhibits microRNA-183-96-182 cluster via the beta-Catenin/TCF/LEF-1 pathway in gastric cancer cells. Tang X, Zheng D, Hu P, Zeng Z, Li M, Tucker L, Monahan R, Resnick MB, Liu M, Ramratnam B. Nucleic Acids Res. 2014 Mar;42(5):2988-98. doi: 10.1093/nar/gkt1275. Epub 2013 Dec 13. 10.1093/nar/gkt1275 PubMed 24335145