pFETCh_Donor (EMM0021)
(Plasmid #63934)

• Purpose: (Empty Backbone) 3X Flag with P2A-Neo for 3' tagging of endogenous proteins
• Depositing Labs: Eric Mendenhall, Richard M. Myers
• Publication: Savic et al Genome Res. 2015 Sep 9.

Backbone

• Vector backbone: pHSG299
• Backbone manufacturer: Clontech
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)
• Tag / Fusion Protein:
  • Glycine-Serine-3XFlag-P2A-NeoR (C terminal on backbone)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH10B
• Copy number: Unknown

Cloning Information

• 5′ sequencing primer: cagcaggctgaagttagtagc
• 3′ sequencing primer: cttctatcgccttcttgacgag

Resource Information

• Supplemental Documents:
  • Protocols for pFETCh Cloning and Transfection
• Addgene Notes:
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 12 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: This plasmid is part of the Mendenhall and Meyers CRISPR-based Tagging system to add a tag (currently using FLAG) to endogenous proteins. Please see https://www.addgene.org/crispr/tagging/ for more details.

Information for Cloning Grade DNA (Catalog # 63934-DNA.cg) ( Back to top )

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

• Amount: 2 µg
• Guaranteed Concentration: 100 ng/µl +/- 5 ng/µl
• Pricing: $105 USD
• Storage: DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here