Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #65216)


Item Catalog # Description Quantity Price (USD)
Plasmid 65216 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5238
  • Total vector size (bp) 9335
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    modified AAV-2 rep78
  • Insert Size (bp)
  • Promoter polyhedrin

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (destroyed during cloning)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer AAATGATAACCATCTCGC
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    modified AAV-8 cap
  • Insert Size (bp)
  • Promoter P10

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer ACGGACCTTTAATTCAACCCA
  • 3′ sequencing primer CTTCCGTGTTTCAGTTAGC
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

Rep78 ORF utilizes a non-canonical initiation codon (CTG codon) beginning at nt 6822.

VP1 capsid ORF utilizes a non-canonical initiation codon (ACG codon) beginning at nt 6576.

Additional article references: Le Guiner et al. Mol. Ther. 22:1923-1935 (2014)

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSR660 was a gift from Robert Kotin (Addgene plasmid # 65216 ; ; RRID:Addgene_65216)
  • For your References section:

    A simplified baculovirus-AAV expression vector system coupled with one-step affinity purification yields high-titer rAAV stocks from insect cells. Smith RH, Levy JR, Kotin RM. Mol Ther. 2009 Nov;17(11):1888-96. doi: 10.1038/mt.2009.128. Epub 2009 Jun 16. 10.1038/mt.2009.128 PubMed 19532142