Skip to main content
Holiday Schedule: Addgene will be closed November 26th & 27th for the Thanksgiving Holiday. Order processing and shipping may be delayed during this week. For questions about your shipment please contact [email protected].
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

PAS535 (TJF078)
(Plasmid #65609)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 65609 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 7081
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    E. coli
  • Insert Size (bp)
  • Mutation
  • Promoter T7 lacO
  • Tag / Fusion Protein
    • 6x His (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ctcgatcccgcgaaattaatacg
  • 3′ sequencing primer CTTAAGCATTATGCGGCCGCAAG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    PAS535 (TJF078) was a gift from Pamela Silver (Addgene plasmid # 65609 ; ; RRID:Addgene_65609)
  • For your References section:

    Enhancement of E. coli acyl-CoA synthetase FadD activity on medium chain fatty acids. Ford TJ, Way JC. PeerJ. 2015 Jun 30;3:e1040. doi: 10.7717/peerj.1040. eCollection 2015. 10.7717/peerj.1040 PubMed 26157619