Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pONL-C1_Rab11a
(Plasmid #65707)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 65707 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pONL-C1
  • Backbone manufacturer
    Addgene #64308
  • Backbone size w/o insert (bp) 5600
  • Total vector size (bp) 6300
  • Vector type
    Mammalian Expression, Luciferase
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Rab11a
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    650
  • Promoter CMV
  • Tag / Fusion Protein
    • ONL (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer GAGTTCGTGAAGGTGAAGGGCC
  • 3′ sequencing primer EBV Reverse
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    hmKusabiraOrange2 (gifted from Dr Atsushi Miyawaki)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pONL-C1_Rab11a was a gift from Yasushi Okada (Addgene plasmid # 65707 ; http://n2t.net/addgene:65707 ; RRID:Addgene_65707)
  • For your References section:

    Expanded palette of Nano-lanterns for real-time multicolor luminescence imaging. Takai A, Nakano M, Saito K, Haruno R, Watanabe TM, Ohyanagi T, Jin T, Okada Y, Nagai T. Proc Natl Acad Sci U S A. 2015 Apr 7;112(14):4352-6. doi: 10.1073/pnas.1418468112. Epub 2015 Mar 23. 10.1073/pnas.1418468112 PubMed 25831507