-
Purposeexpression of Cas9 in plants, maize ubiquitin promoter (Pubi), basta selection
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 66188 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAMBIA1300
-
Backbone manufacturerCAMBIA
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10F'
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesS. pyogenes
-
Mutationplant-codon optimized with higher GC contents (62.5%) in the 5’ region (400 bp) and 54.2% overall GC content
- Promoter maize ubiquitin promoter (Pubi)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13pUC-Rev
- 3′ sequencing primer NOSterm-R attgccaaatgtttgaacga (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Accession # KR029110. A fragment containing a modified ccdB flanked by two BsaI sites was cloned into the vector to produce the CRISPR/Cas9 binary vector. This can be used for inserting sgRNA cassette.
Please see our published protocol for using these plasmids. Ma, X. and Liu, Y.-G. 2016. CRISPR/Cas9-based multiplex genome editing in monocot and dicot plants. Curr. Protoc. Mol. Biol. 115:31.6.1-31.6.21. http://onlinelibrary.wiley.com/doi/10.1002/cpmb.10/abstract doi: 10.1002/cpmb.10
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pYLCRISPR/Cas9Pubi-B was a gift from Yao-Guang Liu (Addgene plasmid # 66188 ; http://n2t.net/addgene:66188 ; RRID:Addgene_66188) -
For your References section:
A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. 10.1016/j.molp.2015.04.007 PubMed 25917172