Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #66188)


Item Catalog # Description Quantity Price (USD)
Plasmid 66188 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Vector type
    Plant Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    S. pyogenes
  • Mutation
    plant-codon optimized with higher GC contents (62.5%) in the 5’ region (400 bp) and 54.2% overall GC content
  • Promoter maize ubiquitin promoter (Pubi)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer M13pUC-Rev
  • 3′ sequencing primer NOSterm-R attgccaaatgtttgaacga
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
  • Article Citing this Plasmid

Depositor Comments

Accession # KR029110. A fragment containing a modified ccdB flanked by two BsaI sites was cloned into the vector to produce the CRISPR/Cas9 binary vector. This can be used for inserting sgRNA cassette.

Please see our published protocol for using these plasmids. Ma, X. and Liu, Y.-G. 2016. CRISPR/Cas9-based multiplex genome editing in monocot and dicot plants. Curr. Protoc. Mol. Biol. 115:31.6.1-31.6.21. doi: 10.1002/cpmb.10

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pYLCRISPR/Cas9Pubi-B was a gift from Yao-Guang Liu (Addgene plasmid # 66188 ; ; RRID:Addgene_66188)
  • For your References section:

    A robust CRISPR/Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Ma X, Zhang Q, Zhu Q, Liu W, Chen Y, Qiu R, Wang B, Yang Z, Li H, Lin Y, Xie Y, Shen R, Chen S, Wang Z, Chen Y, Guo J, Chen L, Zhao X, Dong Z, Liu YG. Mol Plant. 2015 Apr 24. pii: S1674-2052(15)00204-X. doi: 10.1016/j.molp.2015.04.007. 10.1016/j.molp.2015.04.007 PubMed 25917172