pETM6-C4-mCherry
(Plasmid #66530)

• Purpose: Expresses mCherry under the control of Mutant T7 Promoter C4
• Depositing Lab: Mattheos Koffas
• Publication: Jones et al Sci Rep. 2015 Jun 11;5:11301. doi: 10.1038/srep11301.
• Sequence Information:

  • Depositor Sequences: Full (1)
  • Addgene Sequences: Partial (2)

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	66530	Plasmid sent as bacteria in agar stab	1	$65	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: pETM6
  (Search Vector Database)
• Backbone size w/o insert (bp): 5155
• Total vector size (bp): 5866
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mCherry
• Species: Synthetic
• Insert Size (bp): 711
• Mutation: Codon Optimized for E. coli
• Promoter: Mutant T7 Promoter - C4

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: cgagatcgatctcgatcccg
• 3′ sequencing primer: GCT AGT TAT TGC TCA GCG G

Resource Information

• Terms and Licenses:
  • UBMTA
  • Clontech Limited Use Label License
• Article Citing this Plasmid:
  • 1 Reference