Kohinoor/pcDNA3
(Plasmid
#67771)
-
PurposeKohinoor for mammalian cell expression in cytosol
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 67771 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKohinoor
-
SpeciesSynthetic
-
Insert Size (bp)675
-
GenBank ID
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer GAAATTAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Kohinoor/pcDNA3 was a gift from Takeharu Nagai (Addgene plasmid # 67771 ; http://n2t.net/addgene:67771 ; RRID:Addgene_67771) -
For your References section:
A fast- and positively photoswitchable fluorescent protein for ultralow-laser-power RESOLFT nanoscopy. Tiwari DK, Arai Y, Yamanaka M, Matsuda T, Agetsuma M, Nakano M, Fujita K, Nagai T. Nat Methods. 2015 Jun;12(6):515-8. doi: 10.1038/nmeth.3362. Epub 2015 Apr 20. 10.1038/nmeth.3362 PubMed 25894946
Map uploaded by the depositor.
