pEGB3 Pnos:Luciferase:Tnos-SF-35S:Renilla:Tnos-35S:P19:Tnos-SF (GB1116)
(Plasmid
#68218)
-
PurposeModule composed of 3 transcriptional units: Luciferase and Renilla proteins, and the Tomato bushy stunt virus (TBSV) silencing suppressor P19 plant expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | ||
---|---|---|---|---|---|---|
Plasmid | 68218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDGB3alpha1
-
Backbone manufacturerself-made; derived from pCambia1302 generated at the Cambia Institute
-
Vector typePlant Expression, Luciferase, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuc / Renilla / P19
-
Insert Size (bp)7468
-
MutationBsaI and BsmBI sites removed
- Promoter Pnos / 35S / 35S
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsaI (destroyed during cloning)
- 3′ cloning site BsaI (destroyed during cloning)
- 5′ sequencing primer GGTGGCAGGATATATTGTGG (Common Sequencing Primers)
Resource Information
-
Terms and Licenses
-
Industry Terms
- Not Available to Industry
Depositor Comments
insert can be released with BsmBI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEGB3 Pnos:Luciferase:Tnos-SF-35S:Renilla:Tnos-35S:P19:Tnos-SF (GB1116) was a gift from Diego Orzaez (Addgene plasmid # 68218 ; http://n2t.net/addgene:68218 ; RRID:Addgene_68218) -
For your References section:
GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Physiol. 2013 Jul;162(3):1618-31. 10.1104/pp.113.217661 PubMed 23669743