pDGB1omega1_SF (GB0158)
(Plasmid
#68242)
-
PurposeTwister plasmid to swap inserts from an omega2 or omega2R vector to any alpha level vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 68242 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepDGB1_omega1
-
Backbone manufacturerself-made; derived from pGreenII generated at the JIC
-
Vector typeSynthetic Biology ; Unspecified
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSolanum lycopersicum intergenic region
-
Insert Size (bp)150
-
MutationBsaI and BsmBI sites removed
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer caacctctcgggcttctgga (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
insert can be released with BsaI
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDGB1omega1_SF (GB0158) was a gift from Diego Orzaez (Addgene plasmid # 68242 ; http://n2t.net/addgene:68242 ; RRID:Addgene_68242) -
For your References section:
GoldenBraid 2.0: a comprehensive DNA assembly framework for plant synthetic biology. Sarrion-Perdigones A, Vazquez-Vilar M, Palaci J, Castelijns B, Forment J, Ziarsolo P, Blanca J, Granell A, Orzaez D. Plant Physiol. 2013 Jul;162(3):1618-31. 10.1104/pp.113.217661 PubMed 23669743