This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #69134)


Item Catalog # Description Quantity Price (USD)
Plasmid 69134 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 4222
  • Vector type
    Mammalian Expression ; Sleeping Beauty transposon
  • Promoter U3MSCV
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ACTAACCAATCAGTTCGCTTCTC
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The EF1a-GFP cassette was isolated from the plasmid pRRLsin.PPTs.EF1a.GFPpre (Bonamino et al., 2004) (provided by Dr. Didier Trono, EPFL, Switzerland) after digestion with ClaI/BstBI and inserted in pT3-Neo previously digested with ClaI.

EGFP has additional 10 amino acids on the c-terminus of EGFP (SGLRSRLASS). Depositor states that these amino acids do not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pT3-Neo-EF1a-GFP was a gift from Martin Bonamino (Addgene plasmid # 69134 ; ; RRID:Addgene_69134)
  • For your References section:

    An Efficient Electroporation Protocol for the Genetic Modification of Mammalian Cells. Chicaybam L, Barcelos C, Peixoto B, Carneiro M, Limia CG, Redondo P, Lira C, Paraguassu-Braga F, Vasconcelos ZF, Barros L, Bonamino MH. Front Bioeng Biotechnol. 2017 Jan 23;4:99. doi: 10.3389/fbioe.2016.00099. eCollection 2016. 10.3389/fbioe.2016.00099 PubMed 28168187