Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1(+) Laccase2 MCS-ciRS7 Exon
(Plasmid #69900)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69900 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pcDNA3.1(+) Laccase2 MCS Exon Vector
  • Backbone size w/o insert (bp) 6926
  • Total vector size (bp) 8368
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ciRS7
  • Alt name
    CDR1as
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1485
  • Entrez Gene
    stw (a.k.a. Dmel_CG42345, CG10398, CG10408, CG30437, CG32838, CG42345, Dmel\CG42345, Dmel_CG30437, Dmel_CG32838, Laccase2, MCO2, laccase2, str)
  • Entrez Gene
    CDR1-AS (a.k.a. CDR1NAT, CDR1as, CIRS7, ciRS-7)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PacI (not destroyed)
  • 3′ cloning site SacII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jorgen Kjems (Aarhus University) provided the ciRS7 insert

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1(+) Laccase2 MCS-ciRS7 Exon was a gift from Jeremy Wilusz (Addgene plasmid # 69900 ; http://n2t.net/addgene:69900 ; RRID:Addgene_69900)
  • For your References section:

    Combinatorial control of Drosophila circular RNA expression by intronic repeats, hnRNPs, and SR proteins. Kramer MC, Liang D, Tatomer DC, Gold B, March ZM, Cherry S, Wilusz JE. Genes Dev. 2015 Oct 8. 10.1101/gad.270421.115 PubMed 26450910