Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Lasso 2
(Plasmid #69936)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 69936 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB1C3
  • Backbone manufacturer
    Standard Registry of Biological Parts
  • Backbone size w/o insert (bp) 2060
  • Total vector size (bp) 2322
  • Modifications to backbone
    Addition of BsaI restriction sites
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Lasso 2
  • Species
    Synthetic
  • Insert Size (bp)
    262
  • Promoter TAATACGACTCACTATAGGG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

See Genebank file for annotations.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Lasso 2 was a gift from Alfonso Jaramillo (Addgene plasmid # 69936 ; http://n2t.net/addgene:69936 ; RRID:Addgene_69936)
  • For your References section:

    Design and Characterization of Topological Small RNAs. Hassall J, MacDonald P, Cordero T, Rostain W, Jaramillo A. Methods Mol Biol. 2015;1316:149-67. doi: 10.1007/978-1-4939-2730-2_13. 10.1007/978-1-4939-2730-2_13 PubMed 25967060