Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Addgene is open for ordering and depositing; find up-to-date details here. To learn more about how we are supporting COVID-19 research and to find related plasmids, check out our COVID-19 and Coronavirus Plasmids & Resources page.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #69938)


Item Catalog # Description Quantity Price (USD)
Plasmid 69938 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 33764655
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Species
  • Insert Size (bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site PstI (unknown if destroyed)
  • 5′ sequencing primer tgccacctgacgtctaagaa
  • 3′ sequencing primer gctcactcaaaggcggtaat
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

Please check Genbank file for complete sequence annotation.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSCKbreak12 was a gift from Alfonso Jaramillo (Addgene plasmid # 69938 ; ; RRID:Addgene_69938)
  • For your References section:

    Dynamic signal processing by ribozyme-mediated RNA circuits to control gene expression. Shen S, Rodrigo G, Prakash S, Majer E, Landrain TE, Kirov B, Daros JA, Jaramillo A. Nucleic Acids Res. 2015 May 26;43(10):5158-70. doi: 10.1093/nar/gkv287. Epub 2015 Apr 27. 10.1093/nar/gkv287 PubMed 25916845