-
Purposemammalian expression of MKLP1 with an mCherry fusion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 70154 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepmCherry-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4722
- Total vector size (bp) 7274
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameMKLP1
-
Alt namekinesin family member 23
-
Alt nameKIF23
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2574
-
Entrez GeneKIF23 (a.k.a. CDA3, CDAIII, CDAN3, CDAN3A, CHO1, KNSL5, MKLP-1, MKLP1)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer Cherry-F ccccgtaatgcagaagaaga
- 3′ sequencing primer SV40pA-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that there are two silent mutations at position 2673 and 4203. The former is an artificial SalI site and the latter a polymorphism (I think). They also have Gly (GGG) artificially inserted between the starting methionine and the lysine 2.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pmCherry-C1-MKLP1 was a gift from Masanori Mishima (Addgene plasmid # 70154 ; http://n2t.net/addgene:70154 ; RRID:Addgene_70154) -
For your References section:
ARF6 GTPase protects the post-mitotic midbody from 14-3-3-mediated disintegration. Joseph N, Hutterer A, Poser I, Mishima M. EMBO J. 2012 May 30;31(11):2604-14. doi: 10.1038/emboj.2012.139. Epub 2012 May 11. 10.1038/emboj.2012.139 PubMed 22580824