pRL25
(Plasmid #70253)

• Purpose: (Empty Backbone) Shuttle vector suitable for transfer to Anabaena (Nostoc) sp. strain PCC 7120 and other cyanobacterial strains
• Depositing Lab: Peter Wolk
• Publication: Wolk et al J Bacteriol. 1988 Mar;170(3):1239-44.

Backbone

• Vector backbone: Derivative of pBR322 and pDU1
• Backbone size (bp): 9841
• Vector type: Bacterial shuttle vector
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: pBR322ori-3 tttgtttgcaagcagcagat

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pDU1 was derived from Nostoc sp. strain PCC 7524; pBR322 was openly available

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Multiple references:
(i) Wolk CP, Vonshak A, Kehoe P, Elhai J (1984) Construction of shuttle vectors capable of conjugative transfer from Escherichia coli to nitrogen-fixing filamentous cyanobacteria. Proc Natl Acad Sci USA 81: 1561-1565
(ii) Schmetterer G, Wolk CP (1988) Identification of the region of cyanobacterial plasmid pDU1 necessary for replication in Anabaena sp strain M-131. Gene 62: 101-109
(iii) Wolk CP, Cai Y, Cardemil L, Flores E, Hohn B, Murry M, Schmetterer G, Schrautemeier B, Wilson R (1988) Isolation and complementation of mutants of Anabaena sp. strain PCC 7120 unable to grow aerobically on dinitrogen. J Bacteriol 170: 1239-1244
Wolk CP, Fan Q, Zhou R, Huang G, Lechno-Yossef S, Kuritz T, Wojciuch E (2007) Paired cloning vectors for complementation of mutations in the cyanobacterium Anabaena sp. strain PCC 7120. Arch Microbiol 188: 551-563