pLV-tetO-Esrrb
(Plasmid #71152)

• Purpose: Lentiviral plasmid for tetracycline/doxycycline dependent expression of murine Esrrb
• Depositing Lab: Hubert Schorle
• Publication: Kubaczka et al Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005.

Backbone

• Vector backbone: pLV-tetO
• Backbone manufacturer: Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
• Backbone size w/o insert (bp): 8370
• Total vector size (bp): 9707
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Estrogen related receptor, beta
• Alt name: Esrrb
• Alt name: s Err2, ERR2, ERRb, Estrrb
• Species: M. musculus (mouse)
• Insert Size (bp): 9707
• GenBank ID: ENSMUST00000021680
• Entrez Gene: Esrrb (a.k.a. Err2, Errb, Estrrb, Nr3b2)
• Promoter: tetO

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
• 3′ sequencing primer: WPRE-R: CATAGCGTAAAAGGAGCAACA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The cDNA sequence of murine Esrrb was amplified from trophoblast stem cells and subcloned into the pCR2.1 vector. From there it was excised via flanking EcoRI sites and inserted into the pLV-tetO vector via the EcoRI. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).