Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #71152)


Item Catalog # Description Quantity Price (USD)
Plasmid 71152 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Hochedlinger Lab (Stadtfeld et al Cell Stem Cell. 2008 Mar 6. 2(3):230-40.)
  • Backbone size w/o insert (bp) 8370
  • Total vector size (bp) 9707
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Estrogen related receptor, beta
  • Alt name
  • Alt name
    s Err2, ERR2, ERRb, Estrrb
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    Esrrb (a.k.a. Err2, Errb, Estrrb, Nr3b2)
  • Promoter tetO

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CMV-Promoter F: ACGCCATCCACGCTGTTTTGACCT
  • 3′ sequencing primer WPRE-R: CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The cDNA sequence of murine Esrrb was amplified from trophoblast stem cells and subcloned into the pCR2.1 vector. From there it was excised via flanking EcoRI sites and inserted into the pLV-tetO vector via the EcoRI. The pLV-tetO vector backbone was obtained through EcoRI mediated excision of Oct4 cDNA from pLV-tetO-Oct4 (Stadtfeld et al., 2008, addgene Plasmid #19766), kindly provided by K. Hochedlinger (Harvard University).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLV-tetO-Esrrb was a gift from Hubert Schorle (Addgene plasmid # 71152 ; ; RRID:Addgene_71152)
  • For your References section:

    Direct Induction of Trophoblast Stem Cells from Murine Fibroblasts. Kubaczka C, Senner CE, Cierlitza M, Arauzo-Bravo MJ, Kuckenberg P, Peitz M, Hemberger M, Schorle H. Cell Stem Cell. 2015 Sep 22. pii: S1934-5909(15)00360-4. doi: 10.1016/j.stem.2015.08.005. 10.1016/j.stem.2015.08.005 PubMed 26412560