Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #71443)


Item Catalog # Description Quantity Price (USD)
Plasmid 71443 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 11100
  • Vector type
    Mammalian Expression, Retroviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    KMT2A (a.k.a. ALL-1, ALL1, CXXC7, HRX, HTRX, HTRX1, MLL, MLL1, MLL1A, TRX1, WDSTS)
  • Promoter MSCV
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HpaI (destroyed during cloning)
  • 3′ cloning site NsiI (not destroyed)
  • 5′ sequencing primer cccttgaacctcctcgttcgacc
  • 3′ sequencing primer CCAAAAGACGGCAATATGGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Jay Hess (University of Michigan)
  • Articles Citing this Plasmid

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMIG-FLAG-MLL-AF9 was a gift from Daisuke Nakada (Addgene plasmid # 71443 ; ; RRID:Addgene_71443)
  • For your References section:

    AMPK Protects Leukemia-Initiating Cells in Myeloid Leukemias from Metabolic Stress in the Bone Marrow. Saito Y, Chapple RH, Lin A, Kitano A, Nakada D. Cell Stem Cell. 2015 Sep 29. pii: S1934-5909(15)00374-4. doi: 10.1016/j.stem.2015.08.019. 10.1016/j.stem.2015.08.019 PubMed 26440282