Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #72688)


Item Catalog # Description Quantity Price (USD)
Plasmid 72688 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 11391
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    Tbx 5
  • Species
    M. musculus (mouse)
  • Entrez Gene
  • Promoter CMV-Doxycycline

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer pSAM 2 SEQ F - 5' GCTCGTTTAGTGAACCGTCAG 3'
  • 3′ sequencing primer pSAM2 SEQ R - 5' GAGGAACTGCTTCCTTCACG 3'
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSAM2_mCherry_Tbx5 was a gift from Timothy Kamp (Addgene plasmid # 72688 ; ; RRID:Addgene_72688)
  • For your References section:

    Lineage Reprogramming of Fibroblasts into Proliferative Induced Cardiac Progenitor Cells by Defined Factors. Lalit PA, Salick MR, Nelson DO, Squirrell JM, Shafer CM, Patel NG, Saeed I, Schmuck EG, Markandeya YS, Wong R, Lea MR, Eliceiri KW, Hacker TA, Crone WC, Kyba M, Garry DJ, Stewart R, Thomson JA, Downs KM, Lyons GE, Kamp TJ. Cell Stem Cell. 2016 Mar 3;18(3):354-67. doi: 10.1016/j.stem.2015.12.001. Epub 2016 Feb 11. 10.1016/j.stem.2015.12.001 PubMed 26877223