FCIV1-GR S155A
(Plasmid
#72702)
-
PurposeLentiviral expression of GR Phospho-deficient mutant (2nd generation)
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 72702 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneFCIV1
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGR
-
Alt nameNR3C1
-
Alt namenuclear receptor subfamily 3, group C, member 1
-
SpeciesR. norvegicus (rat)
-
MutationS155A
- Promoter ubiquitin
-
Tag
/ Fusion Protein
- IRES-Venus (C terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer FCIV1-5 (gttagacgaagcttgggctgcaggtcgac)
- 3′ sequencing primer EGFP-N (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FCIV1-GR S155A was a gift from Freddy Jeanneteau (Addgene plasmid # 72702 ; http://n2t.net/addgene:72702 ; RRID:Addgene_72702) -
For your References section:
Neurotrophic-priming of glucocorticoid receptor signaling is essential for neuronal plasticity to stress and antidepressant treatment. Arango-Lievano M, Lambert WM, Bath KG, Garabedian MJ, Chao MV, Jeanneteau F. Proc Natl Acad Sci U S A. 2015 Nov 16. pii: 201509045. 10.1073/pnas.1509045112 PubMed 26630005